Detailed mapping, mutation analysis, and intragenic polymorphism identification in candidate Noonan syndrome genes MYL2, DCN, EPS8, and RPL6.

DNA-testing for Huntington disease: pretest attitudes and expectations of applicants and their partners in the Dutch program. Five year study of prenatal testing for Huntington's disease: demand, attitudes, and psychological assessment. Detailed mapping, mutation analysis, and intragenic polymorphism identification in candidate Noonan syndrome genes MYL2, DCN, EPS8, and RPL6 EDITOR—Noonan syndrome (NS) is an autosomal dominant developmental disorder in which the cardinal features include short stature, typical facies with hypertelorism, ptosis, downward slanting palpebral fissures, and low set, posteriorly rotated ears. In addition, there is a notable cardiac involvement seen in these patients, principally pulmonary valve stenosis and hypertrophic obstructive cardiomy-opathy. 1 2 The frequency of NS has been estimated to be between 1:1000-1:2500 live births. 2 3 Using linkage analysis in a large three generation pedigree, we have previously mapped a gene for NS to an interval of more than 6 cM on 12q24 flanked by the markers D12S1637 and NOS1. 4 5 A similar analysis in smaller two generation families showed genetic heterogeneity for this disorder. 4 Despite the relatively high incidence of NS, there appears to be a distinct lack of large families suitable for linkage analysis, possibly resulting from an increase of infertility in males. 6 However, the location of the NS gene has recently been further refined to a 5 cM interval through the identification of additional recombinants in one additional large NS family. 7 No chromosome rearrangements associated with the disease have so far been discovered. In view of this, one approach currently being used to identify the underlying gene responsible for this disorder is examination of candidate genes from within this large region of chromosome 12. We present below the examination of four candidate genes, the precise localisation of three of which, epidermal growth factor receptor pathway substrate-8 (EPS8), decorin (DCN), and myosin light chain 2 (MYL2), had not previously been accurately determined. The fourth, ribosomal protein L6 (RPL6) was known to lie within the NS interval on 12q24. 8 PCR was used to produce gene specific products for FISH (see below) and to produce exonic fragments for SSCP (see below). Sequence information from the cDNA clones of epidermal growth factor receptor pathway substrate-8 (EPS8) and decorin (DCN) were used to design primers for FISH. Primers used were GACAACTAACAGCATCCAGC (DCN-F), GGATTC-CTACTTGCCTTGGA (DCN-R), CTTCCTTAT-TCTTGGTGT (EPS8-F), and CTCGAACTTGGGT-CATTG (EPS8-R). The primers used for SSCP analysis of the MYL2 and RPL6 genes, and for the FISH …